ADD140_DCP_0002
add Riboswitch 13-140, V. vulnificus
GeneralConstruct
- RMDB ID
ADD140_DCP_0002- Name
- add Riboswitch 13-140, V. vulnificus
- Sequence (128 nt)
- CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUCUGUCGCUUUAUCCGAAAUUUUAUAAAGAGAAGACUCAUGAAUUACUUUGACCUGCCG
- Structure
- ..(((((((...((((((.........))))))........((((((.......))))))..))))))).......((((((..........))))))..............................
- Offset
- 12
- # of constructs
- 101
- # of data points
- 3840
- Last modified
- 07/28/24
- Version
- 1
- Owner
- Siqi Tian
Comments
Data for WT and mutant backgrounds Lock-P1, Lock-P2, Lock-P4A, Lock-P4B, and Lock-P1B are included. RNA was heat to 90 C for 2 min and cool on ice for 2 min, then incubated at 37 C for 20 min at pH 8.0 with 10 mM MgCl2 to aid folding. Additional sequences at 5' and 3' end not shown. Data are normalized based on GAGUA pentaloops in flanking sequences (not shown). SHAPE and Terbium normalized so that all 5 loop residues give mean reactivity of 1.0. DMS normalized so that 2 A residues in loop give mean reactivity of 1.0. Glyoxal normalized so that middle G residue in loop give mean reactivity of 1.0. UV302 normalized so that 2 C residues in linker give mean reactivity of 1.0.
Annotation
- processing: backgroundSubtraction, overmodificationCorrection
- temperature: 24C
- chemical: Na-HEPES:50mM(pH8.0), MgCl2:10mM, adenine:5mM
Citation
Tian S, Kladwang W, Das R Allosteric mechanism of the V. vulnificus adenine riboswitch resolved by four-dimensional chemical mapping. eLife (2018) . doi:10.7554/eLife.29602 . PMID:29446752