BSUGLY_DMS_0011
Bacillus subtilis gcvT glycine riboswitch A75U, A76G variant, cotranscriptionally folded, 0 mM glycine
GeneralConstruct
- RMDB ID
BSUGLY_DMS_0011- Name
- Bacillus subtilis gcvT glycine riboswitch A75U, A76G variant, cotranscriptionally folded, 0 mM glycine
- Sequence (284 nt)
- GAAAAUAUGAGCGAAUGACAGCAAGGGGAGAGACCUGACCGAAAACCUCGGGAUACAGGCGCCGAAGGAGCAAACUGCGGAGUGUGUCUCUCAGGCAAAAGAACUCUUGCUCGACGCAACUCUGGAGAGUGUUUGUGCGGAUGCGCAAACCACCAAAGGGGACGUCUUUGCGUAUGCAAAGUAAACUUUCAGGUGCCAGGACAGAGAACCUUCAUUUUACAUGAGGUGUUUCUCUGUCCUUUUUUGUAUCCUGAUUCGUCAGGCGAUGUGUGCUGGAAGACAUU
- Structure
- ............................................................................................................................................................................................................................................................................................
- Offset
- 10
- # of constructs
- 266
- # of data points
- 40280
- Last modified
- 05/20/25
- Version
- 1
- Owner
- Eric Strobel
Comments
Sequencing reads were demultiplexed by transcript length and channel using the TECtools cotrans_preprocessor script Neighboring transcript smoothing was applied Mutation mapping and reactivity calculation was performed using shapemapper2 (Busan and Weeks, DOI: 10.1261/rna.061945.117) Reactivity values were normalized as described in section 3.2.1 of Low and Weeks, 2010, DOI: 10.1016/j.ymeth.2010.06.007 The leading SC1 hairpin sequence (5-ATGGCCTTCGGGCCAA), which is masked by a primer, was trimmed Transcripts from 232 to 259 and after 263 were not enriched by template DNA strand biotin-streptavidin roadblocks and may be poor quality Data are from two independent replicates that were analyzed separately then merged and normalized
Annotation
- experiment: TECprobe-VL
- modifier: DMS
- temperature: 37C
- chemical: Tris-HCl:100mM (pH8.0), KCl:50mM, EDTA:0.1mM, DTT:1mM, MgCl2:10mM, NTPs:50uM, BSA:0.1mg/mL, glycine:none
Citation
Serena Teh and Eric J. Strobel .