BSUGLY_DMS_0014
Bacillus subtilis gcvT glycine riboswitch delta P0 variant, cotranscriptionally folded, 1 mM glycine
GeneralConstruct
- RMDB ID
BSUGLY_DMS_0014- Name
- Bacillus subtilis gcvT glycine riboswitch delta P0 variant, cotranscriptionally folded, 1 mM glycine
- Sequence (265 nt)
- AGCAAGGGGAGAGACCUGACCGAAAACCUCGGGAUACAGGCGCCGAAGGAGCAAACUGCGGAGUGAAUCUCUCAGGCAAAAGAACUCUUGCUCGACGCAACUCUGGAGAGUGUUUGUGCGGAUGCGCAAACCACCAAAGGGGACGUCUUUGCGUAUGCAAAGUAAACUUUCAGGUGCCAGGACAGAGAACCUUCAUUUUACAUGAGGUGUUUCUCUGUCCUUUUUUGUAUCCUGAUUCGUCAGGCGAUGUGUGCUGGAAGACAUU
- Structure
- .........................................................................................................................................................................................................................................................................
- Offset
- 0
- # of constructs
- 247
- # of data points
- 35055
- Last modified
- 05/20/25
- Version
- 1
- Owner
- Eric Strobel
Comments
Sequencing reads were demultiplexed by transcript length and channel using the TECtools cotrans_preprocessor script Neighboring transcript smoothing was applied Mutation mapping and reactivity calculation was performed using shapemapper2 (Busan and Weeks, DOI: 10.1261/rna.061945.117) Reactivity values were normalized as described in section 3.2.1 of Low and Weeks, 2010, DOI: 10.1016/j.ymeth.2010.06.007 The leading SC1 hairpin sequence (5-ATGGCCTTCGGGCCAA), which is masked by a primer, was trimmed Transcripts from 223 to 250 and after 254 were not enriched by template DNA strand biotin-streptavidin roadblocks and may be poor quality Data are from two independent replicates that were analyzed separately then merged and normalized True offset is -9, sequence begins at A10 due to deletion of the first 9 nucleotides
Annotation
- experiment: TECprobe-VL
- modifier: DMS
- temperature: 37C
- chemical: Tris-HCl:100mM (pH8.0), KCl:50mM, EDTA:0.1mM, DTT:1mM, MgCl2:10mM, NTPs:50uM, BSA:0.1mg/mL, glycine:1mM
Citation
Serena Teh and Eric J. Strobel .