RYOSFL_MOD_0001
RYOS-Followup1-Default title
GeneralConstruct
- RMDB ID
RYOSFL_MOD_0001- Name
- RYOS-Followup1-Default title
- Sequence (107 nt)
- GGAAACGAUAGCAGAAGAGAUCGAUAUAGAGCAUAAGCUAAGAAUAGAAUAGAUAAGAUAGUAGCAUCAGAAGGCUUCGGCCUUUUAAAAGAAACAACAACAACAAC
- Structure
- .....((((..(....)..))))......(((....))).............................(((((((....))))))).....................
- Offset
- 0
- # of constructs
- 1
- # of data points
- 1044
- Last modified
- 07/28/24
- Version
- 1
- Owner
- Hannah Wayment-Steele
Comments
Inline hydrolysis (degradation) vs. SHAPE for individual constructs probed by CE (capillary electrophoresis). RNA was transcribed with standard nucleotides, with 5-methyl-cytidine instead of C, with pseudouridine instead of U, or with 1-methyl-pseudouridine instead of U RNA was incubated in 50 mM CHES pH 10, 10 mM MgCl2 for 40 Hr; or treated with DMS or SHAPE reagent 1M7 at pH 8, 10 mM MgCl2. Data are normalized so that numbers reflect modification rates *per hour*. Note: Taken in Nov. 2020 to followup on observations that PSU stabilize against degradation, 110620_RYOS-I-Followup-ModifiedRNA.
Annotation
- processing: backgroundSubtraction, overmodificationCorrection
- temperature: 24C
Citation
Leppek K, Byeon GW, Kladwang W, Wayment-Steele HK, Kerr CH, Xu AF, Kim DS, Topkar VV, Choe C, Rothschild D, Tiu GC, Wellington-Oguri R, Fujii K, Sharma E, Watkins AM, Nicol JJ, Romano J, Tunguz B, Diaz F, Cai H, Guo P, Wu J, Meng F, Shi S, Participants E, Dormitzer PR, Solórzano A, Barna M, Das R Combinatorial optimization of mRNA structure, stability, and translation for RNA-based therapeutics. Nature communications (2022) . doi:10.1038/s41467-022-28776-w . PMID:35318324