ZTPRSW_BZCN_0005
pfl ZTP Riboswitch, C. beijerinckii, 1 mM ZMP, Replicate 2
GeneralConstruct
- RMDB ID
ZTPRSW_BZCN_0005- Name
- pfl ZTP Riboswitch, C. beijerinckii, 1 mM ZMP, Replicate 2
- Sequence (132 nt)
- AUAUUAGAUAUUAGUCAUAUGACUGACGGAAGUGGAGUUACCACAUGAAGUAUGACUAGGCAUAUUAUCUUAUAUGCCACAAAAAGCCGACCGUCUGGGCAAAAAAAGCCUGGAUUGCGUCGGCUUUUUUAU
- Structure
- ....................................................................................................................................
- Offset
- 0
- # of constructs
- 104
- # of data points
- 8240
- Last modified
- 11/04/19
- Version
- 1
- Owner
- Eric Strobel
Comments
REACTIVITY and READS are stored below in groups for each replicate. Reactivity is first, then positive reads, followed by unmodified reads Reactivities are reported as rhos rho_i = theta_i * L, where L = length of RNA sequence See Aviran, S., Lucks, J.B., and Pachter, L. (doi:10.1109/Allerton.2011.6120379) for theta_i and beta_i reactivity definitions Cotranscriptionally folded wt C. beijerinckii pfl ZTP riboswitch with 1mM ZMP, 30 seconds of transcription Linker sequences removed Transcipt lengths 88 and 110 (lines 59 and 81) contain junk reactivities due to ambiguous alignment of transcript 3' ends and should be ignored
Annotation
- experiment: cotranscriptional SHAPE-Seq
- modifier: BzCN
- chemical: ZMP:1mM chemical:DMSO:2% chemical:Tris-acetate:20mM (pH8.0) chemical:MgCl2:10mM chemical:EDTA:0.1mM chemical:DTT:1mM chemical:KCl:50mM chemical:NTPs:500uM chemical:BSA:1mg/mL temperature:37C
Citation
Strobel EJ, Cheng L, Berman KE, Carlson PD, Lucks JB A ligand-gated strand displacement mechanism for ZTP riboswitch transcription control. Nature chemical biology (2019) . doi:10.1038/s41589-019-0382-7 . PMID:31636437