ZTPRSW_BZCN_0009
pfl ZTP Riboswitch, C. beijerinckii, 1 mM ZMP, SSIV RT, Replicate 1
GeneralConstruct
- RMDB ID
ZTPRSW_BZCN_0009- Name
- pfl ZTP Riboswitch, C. beijerinckii, 1 mM ZMP, SSIV RT, Replicate 1
- Sequence (157 nt)
- AUAUUAGAUAUUAGUCAUAUGACUGACGGAAGUGGAGUUACCACAUGAAGUAUGACUAGGCAUAUUAUCUUAUAUGCCACAAAAAGCCGACCGUCUGGGCAAAAAAAGCCUGGAUUGCGUCGGCUUUUUUAUAUGGAAAAGGAGGAAGGAUCUAUGA
- Structure
- .............................................................................................................................................................
- Offset
- 0
- # of constructs
- 10
- # of data points
- 1352
- Last modified
- 11/04/19
- Version
- 1
- Owner
- Eric Strobel
Comments
REACTIVITY and READS are stored below in groups for each replicate. Reactivity is first, then positive reads, followed by unmodified reads Reactivities are reported as rhos rho_i = theta_i * L, where L = length of RNA sequence See Aviran, S., Lucks, J.B., and Pachter, L. (doi:10.1109/Allerton.2011.6120379) for theta_i and beta_i reactivity definitions Cotranscriptionally folded C. beijerinckii pfl ZTP riboswitch with 1mM ZMP, 30 seconds of transcription, SSIV reverse transcription Linker sequences removed
Annotation
- experiment: cotranscriptional SHAPE-Seq
- modifier: BzCN
- chemical: ZMP:1mM chemical:DMSO:2% chemical:Tris-acetate:20mM (pH8.0) chemical:MgCl2:10mM chemical:EDTA:0.1mM chemical:DTT:1mM chemical:KCl:50mM chemical:NTPs:500uM chemical:BSA:1mg/mL temperature:37C
Citation
Strobel EJ, Cheng L, Berman KE, Carlson PD, Lucks JB A ligand-gated strand displacement mechanism for ZTP riboswitch transcription control. Nature chemical biology (2019) . doi:10.1038/s41589-019-0382-7 . PMID:31636437